EST details — SGN-E393931

Search information 
Request: 393931Match: SGN-E393931
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172930Clone name: TUS-14-M24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172930 is on microarray TOM1 spot ID 1-1-1.1.20.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14304 [cLEC-7-H6] Trace: SGN-T25492 EST: SGN-E202210 Direction: 5' Facility: TIGR
Clone: SGN-C172930 [TUS-14-M24] Trace: SGN-T195407 EST: SGN-E394081 Direction: 3' Facility: INRA
Clone: SGN-C172930 [TUS-14-M24] Trace: SGN-T195407 EST: SGN-E399548 Direction: 3' Facility: INRA
Clone: SGN-C172930 [TUS-14-M24] Trace: SGN-T195408 EST: SGN-E394082 Direction: 5' Facility: INRA
Clone: SGN-C172930 [TUS-14-M24] Trace: SGN-T200223 EST: SGN-E399098 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E393931Length: 638 bp (826 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E393931 [] (trimmed) AATAAGGATAGACAATTGAATAACAAGACTTGATCCAAGATTGCAGTGTGTTCTTTTCCACTTCTTGTTTCAATAAATGGTAAAATCTTTGCAGG
CAATGGCAAGTGGTTTCGACAAATTTGGCAGGAATTATAGCAACCTACTCAAGAAGCTTATTGCAAGTGCTCACCCCAACAGCAGCAGCAAGATG
CCAACCAGCATGCAAGAAAGGTGTTTCAGGAAAGACATCATCAGCTATGAAAAGAGCACCCCCTAGCAACGATGACATTTTGTGCACATTGTGAC
TCATCCTTAGATCCGGATCTTGAAGTGCTCTTTTGGCAAATGCAACCTCCATCATTCCAGTGTGCACAGCAGAAACCATCAAAGGTTGGATCGGT
AGGAGGACTGCAGACGCTGCCATCAGCAATTTGGGATTCTCATTTCTAAGTGCCCTTGATAGACACACTGTTGCTGTGGGGGGGATTGAGTAGTC
AGCCCATCTCATATAGCGCCTTATTTTGCCTCTCGAAGCATGGTACAAACTGGAGATAATTCCAACTCCAATCAATGAATTGGCATAAAGTTTGC
AATGAAGATTTTTCCTCGAAACCTGAAATCCAAAAGCAATAAAAGGAAAAAAAATGATCACATTCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E393931] SGN-U567235 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195257 [Download][View] Facility Assigned ID: FA0AAD2BG12FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5