EST details — SGN-E393979
Search information |
Request: 393979 | Match: SGN-E393979 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C172773 | Clone name: TUS-14-G11 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172773 is on microarray TOM1 spot ID 1-1-6.3.20.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C10927 [cLEC-6-K23] | Trace: SGN-T23930 | EST: SGN-E202269 | Direction: 5' | Facility: TIGR |
Sequence |
Sequence Id: SGN-E393979 | Length: 251 bp (966 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E393979 [] (trimmed)
GATAAATATTTTCATATATATATATATATATAATACATGATGTAGTTTTTACCCAAGTTACCACATATTGAAGTAGTAGTATGTACAAAATTAGG
AAATTGCTCTGTTTTCATATATTGTTATTAGTCTCAAACAATCACACAACTATGTTTGTTTGTGTTGTTACCATCATAACATTTTGCATAGCTAG
AGCATTACTAATACCCATCGGAATATGGCCGTTATCATTACTGATTTTCTCCGTCTACCTT
AAATTGCTCTGTTTTCATATATTGTTATTAGTCTCAAACAATCACACAACTATGTTTGTTTGTGTTGTTACCATCATAACATTTTGCATAGCTAG
AGCATTACTAATACCCATCGGAATATGGCCGTTATCATTACTGATTTTCTCCGTCTACCTT
Unigenes |
Current Unigene builds | |||||
[SGN-E393979] | SGN-U565600 | Tomato 200607 | Build 2 | 65 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T195305 [Download][View] | Facility Assigned ID: FA0AAD2AD06RM1 |
Submitter: Koni | Sequencing Facility: INRA |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.867 | Expected Error Rate: 0.0068 | Quality Trim Threshold: 14.5 |