EST details — SGN-E394234
| Search information |
| Request: 394234 | Match: SGN-E394234 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C172687 | Clone name: TUS-14-C21 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172687 is on microarray TOM1 spot ID 1-1-4.3.20.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C172687 [TUS-14-C21] | Trace: SGN-T195107 | EST: SGN-E393781 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172687 [TUS-14-C21] | Trace: SGN-T195560 | EST: SGN-E398913 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172687 [TUS-14-C21] | Trace: SGN-T195561 | EST: SGN-E394235 | Direction: 5' | Facility: INRA |
| Clone: SGN-C172687 [TUS-14-C21] | Trace: SGN-T195561 | EST: SGN-E398914 | Direction: 5' | Facility: INRA |
| Clone: SGN-C172687 [TUS-14-C21] | Trace: SGN-T199539 | EST: SGN-E398213 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E394234 | Length: 284 bp (840 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E394234 [] (trimmed)
GACAGAGGCCATGGGGAAAATGGGCTGCTGAGATTCGCGATCCACAGAAGGGTGTACGCGTTTGGCTTGGTACATTCAACACAGCAGAAGATGCT
GCTAGAGCCTATGATGAGGCTGCTAAGCGCATTCGTGGTGATAAGGCTAAACTCAACTTTCCAGCCCCATCACCACCAGCTAAGCGACAGTGCAC
TAGCACTGTCGCTGCTGCTGATACACCACCACCACTACTCCTTGAGAGTTCGGACAACTCTCCTTTGATGAACTTTGTAGATGATGTCCGGTAG
GCTAGAGCCTATGATGAGGCTGCTAAGCGCATTCGTGGTGATAAGGCTAAACTCAACTTTCCAGCCCCATCACCACCAGCTAAGCGACAGTGCAC
TAGCACTGTCGCTGCTGCTGATACACCACCACCACTACTCCTTGAGAGTTCGGACAACTCTCCTTTGATGAACTTTGTAGATGATGTCCGGTAG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E394234] | SGN-U578439 | Tomato 200607 | Build 2 | 74 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T195560 [Download][View] | Facility Assigned ID: FA0AAD2AB11FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.980 | Expected Error Rate: 0.0086 | Quality Trim Threshold: 14.5 |


