EST details — SGN-E394235

Search information 
Request: 394235Match: SGN-E394235
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172687Clone name: TUS-14-C21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172687 is on microarray TOM1 spot ID 1-1-4.3.20.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C172687 [TUS-14-C21] Trace: SGN-T195107 EST: SGN-E393781 Direction: 3' Facility: INRA
Clone: SGN-C172687 [TUS-14-C21] Trace: SGN-T195560 EST: SGN-E394234 Direction: 3' Facility: INRA
Clone: SGN-C172687 [TUS-14-C21] Trace: SGN-T195560 EST: SGN-E398913 Direction: 3' Facility: INRA
Clone: SGN-C172687 [TUS-14-C21] Trace: SGN-T195561 EST: SGN-E398914 Direction: 5' Facility: INRA
Clone: SGN-C172687 [TUS-14-C21] Trace: SGN-T199539 EST: SGN-E398213 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394235Length: 355 bp (846 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394235 [] (trimmed) AAAAAAAAAATCGGAGACATAAGGGCGATTGGGTACGGGCCCCCCCTCGAGACTAGTTCTCCAAGGCGAAGAGAAACAGTTCTCTGCTGAAGAAA
TCTCCTCTATGGTTCTTATTAAGATGAAGGAGATAGCTGAGGCTTTTCTTGGAACAACAATAAAGAATGCTGTTGTTACTGTGCCTGCGTATTTC
AATGACTCTCAACGTCAGGCTACTAAGGATGCTGGAACTATTTCTGGGCTCAATGTTATGCGTATTATCAACGAGCCTACTGCTGCTGCAATTGC
ATATGGACTTGATAAGAAATCAAGTAGTACAGGGGAGAAAACTGTGCTTATTTTTGACTTGGGTGGTGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394235] SGN-U579872 Tomato 200607 Build 2 71 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195561 [Download][View] Facility Assigned ID: FA0AAD2AB11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0024 Quality Trim Threshold: 20.5