EST details — SGN-E394236

Search information 
Request: 394236Match: SGN-E394236
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172689Clone name: TUS-14-C23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172689 is on microarray TOM1 spot ID 1-1-2.3.20.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10807 [cLEC-6-F16] Trace: SGN-T24214 EST: SGN-E202553 Direction: 5' Facility: TIGR
Clone: SGN-C172689 [TUS-14-C23] Trace: SGN-T195299 EST: SGN-E393973 Direction: 5' Facility: INRA
Clone: SGN-C172689 [TUS-14-C23] Trace: SGN-T195562 EST: SGN-E398915 Direction: 5' Facility: INRA
Clone: SGN-C172689 [TUS-14-C23] Trace: SGN-T195741 EST: SGN-E394415 Direction: 3' Facility: INRA
Clone: SGN-C172689 [TUS-14-C23] Trace: SGN-T195741 EST: SGN-E399518 Direction: 3' Facility: INRA
Clone: SGN-C172689 [TUS-14-C23] Trace: SGN-T199433 EST: SGN-E398107 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394236Length: 615 bp (823 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394236 [] (trimmed) GTAATACTTTTCCATCCTTAATTATTGTTTACTGAGAGCACTAGCAATTCTTCAATAATTTAATGTATTACATGTACTTTCGAAATTCCTCCCTA
TTGAAACATCACTTATTTAAGAGGACAAACAAAATCTCAATTTGCCTTTCTATTTGTTGTTGGACTCAAGTTGAGCAGTAGATAAGAACAATTTC
TTGTAGGCCTCACCCAAAGCCACATTTGTAGTACTATAACCACCATCAATAACTAAATTCAAACCACTCACATATTTAGAATCATCGCTTGCCAA
ATACAACACTCCATTTGCCACATCTTGTTCCTCCAATAAAGCTCCTTTCAAATTCCCCCCTTCACCAAACCATTTCTCTGCCTTTTCTCTCTCAT
CTATTCCTAGCGTTTTCAATGCCAATGGTGTCCCAATTCCACTAGGAGAAATACAATTAACTCTTATTCCGTATCTTCCTAATTCGACTCCAACA
TTCTTTGAGAGCCCCAAAACTGCATTTTTTGAGGCCACATAAGTGTGTGGCAAATCGCCATATGTCGTTGCCACCACACTTGCTGTGAATATAAT
GGAACCTTTTGTTTTGGTCGATATCATCACTCTACCAGCGTGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394236] SGN-U578077 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195562 [Download][View] Facility Assigned ID: FA0AAD2AB12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5