EST details — SGN-E394238

Search information 
Request: 394238Match: SGN-E394238
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172719Clone name: TUS-14-E5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172719 is on microarray TOM1 spot ID 1-1-4.1.20.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10849 [cLEC-6-H12] Trace: SGN-T24217 EST: SGN-E202556 Direction: 5' Facility: TIGR
Clone: SGN-C172719 [TUS-14-E5] Trace: SGN-T195109 EST: SGN-E393783 Direction: 3' Facility: INRA
Clone: SGN-C172719 [TUS-14-E5] Trace: SGN-T195564 EST: SGN-E398918 Direction: 3' Facility: INRA
Clone: SGN-C172719 [TUS-14-E5] Trace: SGN-T195565 EST: SGN-E394239 Direction: 5' Facility: INRA
Clone: SGN-C172719 [TUS-14-E5] Trace: SGN-T200171 EST: SGN-E398919 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394238Length: 203 bp (870 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394238 [] (trimmed) CAGGTTCATTGTAGCCTGAGAGAGCAACTTCATGACCACATCAACGCTGAGATTGTTACTGGAACAATCTCTCATAAAGAGGACGCTATGCATTA
TCTCACTTGGACCTACTTGTTTCGTAGATTGATGGTTAACCCAACTTACTATGGCCTAGAGCATGCAAAACCTGCGATTCTGGATTCTTAGTTGA
CCAGCTTGGGACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394238] SGN-U596814 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195564 [Download][View] Facility Assigned ID: FA0AAD2AC03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5