EST details — SGN-E394308

Search information 
Request: 394308Match: SGN-E394308
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183273Clone name: TUS-41-L23
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183273 is on microarray TOM1 spot ID 1-1-2.4.3.14 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183273 [TUS-41-L23] Trace: SGN-T195633 EST: SGN-E394307 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394308Length: 490 bp (842 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394308 [] (trimmed) ATATAAAATTGTCTCAGTTGAGATCAATAATTTTTTGTTAGAAATTTATACATATCTGGTAAAAAATTAATATCAACATAACTAAATCAACAAAT
ATTGCATTAATACAAGTTTAAATAGTCACATGGCTAATAAAGTTTTGACATAAATGGCCTGGTACAAATTTATTTTTTGGTTCTTTAACTTACTG
ATCACAATGTTTACTGATCTTTAACTTACTTTTACTGGCATATTATTAACCACTTCCCAACTAGAATATCCCAACCAACTCCCACTCCTACGCGC
CACCGTCAACAGTGGCCTTGTCGCCGGTTGAAACGTCGGCTCTCATTTTAAGCCACTCAACGACATCTCCAAACACTTGCTCCACATTCTCCTCC
AGTTCTCCAACCAGCTGGTGCCACATACCTGGATAAATCTTCAGTGTTTTGTCCTTGCCTGACAATCGGCGATATAGCTCCTCCGCGCACGCGGG
ATTGCAAATGACATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394308] SGN-U566786 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195634 [Download][View] Facility Assigned ID: FA0AAD29CF12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0151 Quality Trim Threshold: 14.5