EST details — SGN-E394322

Search information 
Request: 394322Match: SGN-E394322
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172636Clone name: TUS-14-A18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172636 is on microarray TOM1 spot ID 1-1-7.1.20.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10725 [cLEC-6-B2] Trace: SGN-T24019 EST: SGN-E202358 Direction: 5' Facility: TIGR
Clone: SGN-C172636 [TUS-14-A18] Trace: SGN-T195204 EST: SGN-E393878 Direction: 3' Facility: INRA
Clone: SGN-C172636 [TUS-14-A18] Trace: SGN-T195361 EST: SGN-E394035 Direction: 5' Facility: INRA
Clone: SGN-C172636 [TUS-14-A18] Trace: SGN-T195648 EST: SGN-E399017 Direction: 5' Facility: INRA
Clone: SGN-C172636 [TUS-14-A18] Trace: SGN-T195772 EST: SGN-E394446 Direction: 3' Facility: INRA
Clone: SGN-C172636 [TUS-14-A18] Trace: SGN-T195772 EST: SGN-E399016 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394322Length: 263 bp (860 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394322 [] (trimmed) TTTTCTCTGCTGAAGAAATCTCCTCTATGGTTCTTATTCCTATTAAGGAGATAGCTGAGGCTTTTCTTGGAACAACAATAAAGAATGCTGTTGTT
ACTGTGCCTGCGTATTTCAATGACTCTCAACGTCAAGCTACTAATGATGCTGGAACTATTTCTGGGCCCAATGATATGCGTTTTATCTTCTAGCC
TACTGCTGCTGCAATTGCTTATGGACTTGATAACAAATCAAGTTTTTCAGGGGAAAAAACTCCGCATTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394322] SGN-U579872 Tomato 200607 Build 2 71 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195648 [Download][View] Facility Assigned ID: FA0AAD2BA09RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0354 Quality Trim Threshold: 14.5