EST details — SGN-E394349

Search information 
Request: 394349Match: SGN-E394349
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172772Clone name: TUS-14-G10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172772 is on microarray TOM1 spot ID 1-1-7.3.20.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10926 [cLEC-6-K22] Trace: SGN-T24140 EST: SGN-E202479 Direction: 5' Facility: TIGR
Clone: SGN-C172772 [TUS-14-G10] Trace: SGN-T195233 EST: SGN-E393907 Direction: 3' Facility: INRA
Clone: SGN-C172772 [TUS-14-G10] Trace: SGN-T195674 EST: SGN-E394348 Direction: 3' Facility: INRA
Clone: SGN-C172772 [TUS-14-G10] Trace: SGN-T195674 EST: SGN-E399056 Direction: 3' Facility: INRA
Clone: SGN-C172772 [TUS-14-G10] Trace: SGN-T200211 EST: SGN-E399057 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394349Length: 406 bp (857 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394349 [] (trimmed) GATTCGCTCATATAGAGGATATATGTCGCGCCCACATATTCCTCATGGAGAATATTAAAGCACAAGGACGATATATATGTTGTGCTCAGAGTTGG
GCATTGACTGAAGTTATCGATCACCTTAAAAACGAGTATCCTTACCTTGATGCAAAAAGGCGCGAAGGACATGATTCAGTGATCCCCTCGGAGAT
TTCATCAAAGAAATTGAGAGGACTCGGATTTTCTTTCAAGTATGAAATCAACGATATCATAAGAGATACAATTACTAGTTGTATACATCATGGAT
TCTTAGCCTCAATTCAAAAGTAAGAATTGCAAATTACATGTACCAAAACCTTAACTCTTACTTTGATGTATCAATATACTCCTTTTAATATCAAT
GAAGTAGAAAATCTTATTATTTTAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394349] SGN-U567541 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195675 [Download][View] Facility Assigned ID: FA0AAD2BD05RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0053 Quality Trim Threshold: 12.5