Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E394358

Search information 
Request: 394358Match: SGN-E394358
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172832Clone name: TUS-14-I22
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172832 is on microarray TOM1 spot ID 1-1-3.1.20.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C11014 [cLEC-6-O21] Trace: SGN-T23942 EST: SGN-E202281 Direction: 5' Facility: TIGR
Clone: SGN-C172832 [TUS-14-I22] Trace: SGN-T195242 EST: SGN-E393916 Direction: 3' Facility: INRA
Clone: SGN-C172832 [TUS-14-I22] Trace: SGN-T195392 EST: SGN-E394066 Direction: 5' Facility: INRA
Clone: SGN-C172832 [TUS-14-I22] Trace: SGN-T195684 EST: SGN-E399544 Direction: 5' Facility: INRA
Clone: SGN-C172832 [TUS-14-I22] Trace: SGN-T199554 EST: SGN-E398228 Direction: 3' Facility: INRA
Clone: SGN-C172832 [TUS-14-I22] Trace: SGN-T199554 EST: SGN-E399071 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394358Length: 353 bp (872 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394358 [] (trimmed) AACAACTGATATAATATAATCAATCGTCAAATTTCGAAACAAGACTCGAGTACATACGATTTTAAACGAAACACAGAAAAAAGAGAAAGTGACAA
CTGATACAACATAGAAAGAAAGGATCCATAAGCAAGATCAATGCTATCTATCTTATTCTTAATTCTCCTCATGAAACCAAATTCTGATGATCAGC
TTTACTGAACTTTAGAGCAGTCAGTAGAGGGGCTGATCTTGTAAGGGATGTTGACACTACAAGTGTTAGGGAGAGCAGCAGCTTTGCCCAAATTG
AGTCCTGTAAAAGAAGAAGCAGCTGATTTTAGGCAAGTGCATGCGGCCTGTCGGTCTACTGTAGTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394358] SGN-U581465 Tomato 200607 Build 2 445 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195684 [Download][View] Facility Assigned ID: FA0AAD2BE11RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0010 Quality Trim Threshold: 14.5