EST details — SGN-E394371
| Search information |
| Request: 394371 | Match: SGN-E394371 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C172910 | Clone name: TUS-14-M4 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C172910 is on microarray TOM1 spot ID 1-1-5.1.20.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C172910 [TUS-14-M4] | Trace: SGN-T195253 | EST: SGN-E393927 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172910 [TUS-14-M4] | Trace: SGN-T195400 | EST: SGN-E394074 | Direction: 5' | Facility: INRA |
| Clone: SGN-C172910 [TUS-14-M4] | Trace: SGN-T195696 | EST: SGN-E394370 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172910 [TUS-14-M4] | Trace: SGN-T195696 | EST: SGN-E399547 | Direction: 3' | Facility: INRA |
| Clone: SGN-C172910 [TUS-14-M4] | Trace: SGN-T195697 | EST: SGN-E399090 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E394371 | Length: 159 bp (912 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E394371 [] (trimmed)
CAGTAAAAGAACACAAAAATCAACACATTATGCACTATAAGGAATATGGCTAATATTAGATAAATACAAGTAGCCTTGATGTTGCTCTTCGAGGA
AATTTGTGGTGGAGTATGAACTGGGAGGGGGACCGGTTTGGGGGGGTAAAGGGGGGGGGAGGGG
AATTTGTGGTGGAGTATGAACTGGGAGGGGGACCGGTTTGGGGGGGTAAAGGGGGGGGGAGGGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E394371] | SGN-U584686 | Tomato 200607 | Build 2 | 52 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T195697 [Download][View] | Facility Assigned ID: FA0AAD2BG02RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.903 | Expected Error Rate: 0.0059 | Quality Trim Threshold: 14.5 |


