Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E394426

Search information 
Request: 394426Match: SGN-E394426
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172863Clone name: TUS-14-K5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172863 is on microarray TOM1 spot ID 1-1-4.3.20.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14167 [cLEC-7-B16] Trace: SGN-T25333 EST: SGN-E202051 Direction: 5' Facility: TIGR
Clone: SGN-C172863 [TUS-14-K5] Trace: SGN-T195752 EST: SGN-E399525 Direction: 3' Facility: INRA
Clone: SGN-C172863 [TUS-14-K5] Trace: SGN-T199437 EST: SGN-E398111 Direction: 3' Facility: INRA
Clone: SGN-C172863 [TUS-14-K5] Trace: SGN-T199542 EST: SGN-E398216 Direction: 5' Facility: INRA
Clone: SGN-C172863 [TUS-14-K5] Trace: SGN-T199586 EST: SGN-E398260 Direction: 5' Facility: INRA
Clone: SGN-C172863 [TUS-14-K5] Trace: SGN-T199586 EST: SGN-E398958 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394426Length: 637 bp (849 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394426 [] (trimmed) GATAAGGCTTACAATGGTGTGATCCATACTTGCAAAATGCATGATATGGTTCGTGATTTGGTGATCAAAATTGCAGATGATGATTCATTTTCCAC
CCCATCTGATGCAAATTGTCGGCATTTGGGTATTAATAGTGCGATGAATGGGAAGCAACTACTGAGCAATCGAAAATTACGAGCACTGCTGACAA
CCACCAAGAGTGGTGAAGTAAACAAAATCCCTTCTGATATTGCTAGGAAGTTCTGCAATAGTCGACACCTCCAGGTACTGGATCTGTCCAAATCA
ATTTTCGATGTGCCTCTTTCAAGTTTGCTGGAAGGCATTGGATCTGCCAGACAGCTTGCTTATCTCAGTTTAAGCAATACACACCCGTTGATTGG
TGTTCCAGATTCCATATCCAATCTTGAAAAATTACAGATTTTGGACTTCAGCTATTGCCAAAATATGAAAATGCTCCCCTCTTGTGTTTTAACAT
TTGTGGAACTAGCAATTTTAGATTTGAACCACTGTGGGTCACTTGAGTACCTGCCAAAAGGATTGAGTAAGCTTTCCAATCTTCAAGTACTGCTT
GGATTTAAGCCTGCAAAATTAAACCAGCGTGGAAGTTGTCTTATTTCTAAACTCAAAAGCCTTACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394426] SGN-U565272 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195752 [Download][View] Facility Assigned ID: FA0AAD2AF03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5