EST details — SGN-E394430

Search information 
Request: 394430Match: SGN-E394430
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C172877Clone name: TUS-14-K19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C172877 is on microarray TOM1 spot ID 1-1-6.3.20.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C14200 [cLEC-7-C8] Trace: SGN-T25244 EST: SGN-E201962 Direction: 5' Facility: TIGR
Clone: SGN-C172877 [TUS-14-K19] Trace: SGN-T200443 EST: SGN-E399527 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394430Length: 395 bp (847 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E394430 [] (trimmed) CCGAGATTCTTCCTATACACAATAATATAACAATTTCACAATCCTTCTATTTCGGCAGAATCTTCATATCAATTTCGATACAAAGTTCGATTATT
TTATTTGTGAAGTCGTGATTTAATATGTCTGGAAATAACAGTTACACCGCGTATAACTCTAACGAGACATCATGGGCTGATCAATGGGATCCAGA
ACCAGCAAGTTATACAATTTTTGACAAGAAAACTGGAAATAATAATACTTCTAAGATTTCGAGTAAAGTTGGAGATACTTTAGGAAAAACTAAAT
ATGTTGCTTCAACTGGGGTTAAAAAGGTAAAATCAAGTGCTACTGCTGGCTTCCAATGGATTAAAGACAAGTGCAATAAGCCTAAGTAAAATTTT
ATTATTATTATTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394430] SGN-U564368 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195756 [Download][View] Facility Assigned ID: FA0AAD2AF10RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0253 Quality Trim Threshold: 14.5