EST details — SGN-E394481

Search information 
Request: 394481Match: SGN-E394481
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183017Clone name: TUS-41-B7
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183017 is on microarray TOM1 spot ID 1-1-2.2.3.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67219 [cLEN-17-N4] Trace: SGN-T91041 EST: SGN-E276620 Direction: 5' Facility: TIGR
Clone: SGN-C183017 [TUS-41-B7] Trace: SGN-T195163 EST: SGN-E393837 Direction: 3' Facility: INRA
Clone: SGN-C183017 [TUS-41-B7] Trace: SGN-T195332 EST: SGN-E394006 Direction: 5' Facility: INRA
Clone: SGN-C183017 [TUS-41-B7] Trace: SGN-T195616 EST: SGN-E398837 Direction: 5' Facility: INRA
Clone: SGN-C183017 [TUS-41-B7] Trace: SGN-T195807 EST: SGN-E399505 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394481Length: 186 bp (863 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394481 [] (trimmed) CTTTTTTTTTAGGATAAATGGTTGGTAAAAATAATTCCTATCACCTCCCTCCTGGATTGAAGTTGCTTCCACCATATGAGGAATTATTCCTGTAT
TATCATCTAAAACAATCTACCTCCAAGCATTGTCAATCTTCTGTCCTCCCCTAGGATGATGTCTATAAGTTCAATCCCTGGGAATTGCCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394481] SGN-U583021 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195807 [Download][View] Facility Assigned ID: FA0AAD29CA04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0431 Quality Trim Threshold: 14.5