EST details — SGN-E394481
| Search information |
| Request: 394481 | Match: SGN-E394481 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183017 | Clone name: TUS-41-B7 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183017 is on microarray TOM1 spot ID 1-1-2.2.3.4 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C67219 [cLEN-17-N4] | Trace: SGN-T91041 | EST: SGN-E276620 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183017 [TUS-41-B7] | Trace: SGN-T195163 | EST: SGN-E393837 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183017 [TUS-41-B7] | Trace: SGN-T195332 | EST: SGN-E394006 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183017 [TUS-41-B7] | Trace: SGN-T195616 | EST: SGN-E398837 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183017 [TUS-41-B7] | Trace: SGN-T195807 | EST: SGN-E399505 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E394481 | Length: 186 bp (863 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E394481 [] (trimmed)
CTTTTTTTTTAGGATAAATGGTTGGTAAAAATAATTCCTATCACCTCCCTCCTGGATTGAAGTTGCTTCCACCATATGAGGAATTATTCCTGTAT
TATCATCTAAAACAATCTACCTCCAAGCATTGTCAATCTTCTGTCCTCCCCTAGGATGATGTCTATAAGTTCAATCCCTGGGAATTGCCTG
TATCATCTAAAACAATCTACCTCCAAGCATTGTCAATCTTCTGTCCTCCCCTAGGATGATGTCTATAAGTTCAATCCCTGGGAATTGCCTG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E394481] | SGN-U583021 | Tomato 200607 | Build 2 | 3 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T195807 [Download][View] | Facility Assigned ID: FA0AAD29CA04FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.937 | Expected Error Rate: 0.0431 | Quality Trim Threshold: 14.5 |


