EST details — SGN-E394489
| Search information |
| Request: 394489 | Match: SGN-E394489 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183107 | Clone name: TUS-41-F1 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183107 is on microarray TOM1 spot ID 1-1-8.2.3.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C67944 [cLEN-22-E20] | Trace: SGN-T91623 | EST: SGN-E276927 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183107 [TUS-41-F1] | Trace: SGN-T195176 | EST: SGN-E393850 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183107 [TUS-41-F1] | Trace: SGN-T195623 | EST: SGN-E394297 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183107 [TUS-41-F1] | Trace: SGN-T195815 | EST: SGN-E399508 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183107 [TUS-41-F1] | Trace: SGN-T200152 | EST: SGN-E398855 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E394489 | Length: 180 bp (923 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E394489 [] (trimmed)
GTTTTTAAAGCTAATTTATAAAACAAACAATGGGCACTTCCTCTGTTTTTCTACTATTCCTTCTTTCTTTTCTTCTCCTTCTCCCGTCCCTCCTT
GCCTCCTCTAATCCTCAACAAGTTGTCGATGAAGTACACAGGTACGTGCATTTTTAATTTTATTATAATTCAGAATTAGATAAAA
GCCTCCTCTAATCCTCAACAAGTTGTCGATGAAGTACACAGGTACGTGCATTTTTAATTTTATTATAATTCAGAATTAGATAAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E394489] | SGN-U585247 | Tomato 200607 | Build 2 | 21 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T195815 [Download][View] | Facility Assigned ID: FA0AAD29CC01FM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.901 | Expected Error Rate: 0.0081 | Quality Trim Threshold: 14.5 |


