EST details — SGN-E394489

Search information 
Request: 394489Match: SGN-E394489
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183107Clone name: TUS-41-F1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183107 is on microarray TOM1 spot ID 1-1-8.2.3.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C67944 [cLEN-22-E20] Trace: SGN-T91623 EST: SGN-E276927 Direction: 5' Facility: TIGR
Clone: SGN-C183107 [TUS-41-F1] Trace: SGN-T195176 EST: SGN-E393850 Direction: 3' Facility: INRA
Clone: SGN-C183107 [TUS-41-F1] Trace: SGN-T195623 EST: SGN-E394297 Direction: 5' Facility: INRA
Clone: SGN-C183107 [TUS-41-F1] Trace: SGN-T195815 EST: SGN-E399508 Direction: 3' Facility: INRA
Clone: SGN-C183107 [TUS-41-F1] Trace: SGN-T200152 EST: SGN-E398855 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394489Length: 180 bp (923 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394489 [] (trimmed) GTTTTTAAAGCTAATTTATAAAACAAACAATGGGCACTTCCTCTGTTTTTCTACTATTCCTTCTTTCTTTTCTTCTCCTTCTCCCGTCCCTCCTT
GCCTCCTCTAATCCTCAACAAGTTGTCGATGAAGTACACAGGTACGTGCATTTTTAATTTTATTATAATTCAGAATTAGATAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394489] SGN-U585247 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195815 [Download][View] Facility Assigned ID: FA0AAD29CC01FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.901 Expected Error Rate: 0.0081 Quality Trim Threshold: 14.5