EST details — SGN-E394605

Search information 
Request: 394605Match: SGN-E394605
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182736Clone name: TUS-40-F14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182736 is on microarray TOM1 spot ID 1-1-3.2.5.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182736 [TUS-40-F14] Trace: SGN-T195930 EST: SGN-E394604 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394605Length: 571 bp (877 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394605 [] (trimmed) GCTCAATTTTAGCCAAATATTTATAATCAAGAACTTATACAAGCTTCATATTTACTCATGACACTAATGGATGTTCTTGGTTACTATGTTATTCC
CCTAATAATTCTATGCTTCACTTATTGGAACTTGAAAAACAAATGGGCCAAAAGTTCAAAGCCAACAAATTGGCCCATTTTTGGAATGTTGCCTG
GATTGGTTCATAATGCTCATAGAATCCATTCATTTTTCACTGATATCCTGTTAGAAACTACTAGTAATTTTGAGTTTCGTGGCCCTATTTTCGCC
AATATGGACATGTTATTCACTAGTGATCCTGCAAACATCCATCATATCCTGAGTCGAAACTTCTCAAACTATCCAAAAGGGCCCGAGTTTCGTGA
AATATTCGATATATTAGGAAATGGAATCTTCAATGTTGATTCTGAACTATGGGAGATTCATAGGAAAACAACCATGTCCCTGATGAACCATTCCA
AGTTCCAGACTTTGCTACAACGTAACGTCTGGGGACACGATCAATAAAAGGATTGTTCCAACTCTTGATATTTTTAGCACAACAGGACCCCCCTG
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394605] SGN-U581637 Tomato 200607 Build 2 33 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195931 [Download][View] Facility Assigned ID: FA0AAD28DC07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5