Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E394634

Search information 
Request: 394634Match: SGN-E394634
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183581Clone name: TUS-42-I19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183581 is on microarray TOM1 spot ID 1-1-6.1.1.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C72804 [cLER-2-E16] Trace: SGN-T92648 EST: SGN-E278930 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394634Length: 561 bp (872 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E394634 [] (trimmed) CATTATTAAATTTGGGAAGTCCCACTTACTAAACATATTTATTGAACAAAAACAAAGTGCAAGGTATTGTCAAAATACCAAATCATTATTGTACT
ACCATACCATAATAATTAATTAAAATTTAACACAATATAATCATTGATAACACTAAAACTTTCTGCAAGGGGGCAACGGTGAACCACAAAGTCCT
TTATTTCCAGCAAATGAATTACCCTTAAACTTTGTTGGTGGAAGTTGACCACTCAAATGATTATTACTCAAATTCAACTTGTTTAGTCCACTAAT
TTCCTTTGAAACTTCCCCATAAACCATATTTCTAAACAAATCCAATTCCTTAATTGTCTTAACAATCTTCATTTTCTCCAAATCAAACTTTAATT
TATTCCCACCACCATAAAATCCAATTAAAAAATCATTCTTATTCAACAGCCCAATCGGACTTCCAGTAATGTCATGAGCGGAGAAATCAATATAG
TCTTAAAAATACTTTGTTTTTGGGTTCCAATCATCCAATTTAATCTTGATCCCGCATTTTGCTACCTTCAATGAAATAAATAATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394634] SGN-U575404 Tomato 200607 Build 2 43 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T195960 [Download][View] Facility Assigned ID: FA0AAD30AE10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.908 Expected Error Rate: 0.0090 Quality Trim Threshold: 14.5