EST details — SGN-E394689

Search information 
Request: 394689Match: SGN-E394689
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183472Clone name: TUS-42-E6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183472 is on microarray TOM1 spot ID 1-1-3.1.2.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C61706 [cLEM-19-D20] Trace: SGN-T86308 EST: SGN-E272310 Direction: 5' Facility: TIGR
Clone: SGN-C183472 [TUS-42-E6] Trace: SGN-T196014 EST: SGN-E394688 Direction: 3' Facility: INRA
Clone: SGN-C183472 [TUS-42-E6] Trace: SGN-T200286 EST: SGN-E399243 Direction: 5' Facility: INRA
Clone: SGN-C183472 [TUS-42-E6] Trace: SGN-T200285 EST: SGN-E399242 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394689Length: 384 bp (879 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394689 [] (trimmed) TGGCAGCTTCGGTCCATTGTGCAACAAGAGCAGCCATAAGAGCAGCACGTGAACAGCTCAAACGTTGGGACAAGCTCGACGAGTCTGCTTCAGAA
TTTTATCTAGATGTCCCTGCAATATTACCAGTTGTGAAGACACAGTGTGGCCTGGATTATGCAGAGAAGTTCGTAGAAACTCTGCTGGCTCGAAA
ATCAACGTGTTTCAAATGATACTAAGCTATGTTGCTCGGACTCTCCAAAGAATGTTATCGTACCTGTGTTGATTCCTCTAAAAATACACTACTTT
TTGAGGATCTGACATGCACCGAGTCATGATCATGTCTACTACATCTTTAATATTCACCAAATTAGTACATGACTAAAGAGCTAGATATGGTAATT
ACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394689] SGN-U582239 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196015 [Download][View] Facility Assigned ID: FA0AAD30BC03RM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5