EST details — SGN-E394698

Search information 
Request: 394698Match: SGN-E394698
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183524Clone name: TUS-42-G10
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183524 is on microarray TOM1 spot ID 1-1-7.3.1.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71787 [cLER-19-C13] Trace: SGN-T96383 EST: SGN-E284811 Direction: 5' Facility: TIGR
Clone: SGN-C183524 [TUS-42-G10] Trace: SGN-T196024 EST: SGN-E399261 Direction: 5' Facility: INRA
Clone: SGN-C183524 [TUS-42-G10] Trace: SGN-T199655 EST: SGN-E398329 Direction: 3' Facility: INRA
Clone: SGN-C183524 [TUS-42-G10] Trace: SGN-T200296 EST: SGN-E399260 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394698Length: 402 bp (868 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394698 [] (trimmed) AAATAATAAGATTTTCTACTTCATTGATATTAAAAGGAGTATACTGATACATCAAAGTAAGAGTTAAGGTTTTGGTACATGTAATTTGCAATTCT
TACTTTTGAATTGAGGCTAAAAATCCATGATGTATACAACTAATAATTGTATCTCTTATGATATCGTTGATTTCATACTTGAAAGAAAATCCGAG
TCCTCTCAATTTCTTTGATGAAATCTCCGAGGGGATCACTGAATCATGTCCTCCGCGCCTCTCTGCATCAAGGTAAGGATACTCGTTTTTAAGGT
GATCGATAACTTCATACAATGCCCAACTCTGAGCACAACATATATATCGTCCTTGTGCTTTAATATTCTCCATGAGGAATATGTGGGCGCGACAT
ATATCCTCTATATGAGCTAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394698] SGN-U567541 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196024 [Download][View] Facility Assigned ID: FA0AAD30BD05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0025 Quality Trim Threshold: 12.5