EST details — SGN-E394750
| Search information |
| Request: 394750 | Match: SGN-E394750 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183499 | Clone name: TUS-42-F9 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183499 is on microarray TOM1 spot ID 1-1-8.2.1.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C34181 [cLEG-30-A19] | Trace: SGN-T69163 | EST: SGN-E255437 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C183499 [TUS-42-F9] | Trace: SGN-T196075 | EST: SGN-E394749 | Direction: 3' | Facility: INRA |
| Clone: SGN-C183499 [TUS-42-F9] | Trace: SGN-T200350 | EST: SGN-E399361 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E394750 | Length: 137 bp (868 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E394750 [] (trimmed)
GTTTTAAACAAATTTTCTTAAAAGGTGAGTTTTTTTCTTATGGTTAAATGATGCAAGTGCTTCATCACTTTCATAAAGCATTTGAATCCCCTTAT
ATATTTGTGCAGAAGAGAGCTACTTCATAATGGATATTATAT
ATATTTGTGCAGAAGAGAGCTACTTCATAATGGATATTATAT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E394750] | SGN-U590607 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T196076 [Download][View] | Facility Assigned ID: FA0AAD30CC05RM2 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.904 | Expected Error Rate: 0.0746 | Quality Trim Threshold: 14.5 |


