Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E394792

Search information 
Request: 394792Match: SGN-E394792
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183487Clone name: TUS-42-E21
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183487 is on microarray TOM1 spot ID 1-1-4.1.1.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C71299 [cLER-17-H17] Trace: SGN-T96034 EST: SGN-E283183 Direction: 5' Facility: TIGR
Clone: SGN-C183487 [TUS-42-E21] Trace: SGN-T195946 EST: SGN-E394620 Direction: 5' Facility: INRA
Clone: SGN-C183487 [TUS-42-E21] Trace: SGN-T195946 EST: SGN-E399144 Direction: 5' Facility: INRA
Clone: SGN-C183487 [TUS-42-E21] Trace: SGN-T200237 EST: SGN-E399143 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394792Length: 295 bp (868 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394792 [] (trimmed) AAATTTCTAATTTAGCATATATGACTGGCAAAATTTTCATTTACACTATAAATGCTGATATAAAGCGCACAAAATACCTAAAAGATCAAACTAAA
GCCATCTTAGTTTCCAAGCAAATATGTCAAAATTGCCAAAACACCAATCACAATTATGATATTGAGAAAATAGTTCGTCGGGAGAAGCTTATTCT
GGGGTTCCCTCCCAACCCCTCGTATTCTGCTCGAATCTTTTGTTTCATAGCATCCGAGAGCTCTCTCTTTCCAGTTGAGTATTTTGCTGCGAAGA
AACATCTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394792] SGN-U574727 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196118 [Download][View] Facility Assigned ID: FA0AAD30AC11FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0276 Quality Trim Threshold: 14.5