EST details — SGN-E394817

Search information 
Request: 394817Match: SGN-E394817
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183618Clone name: TUS-42-K8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183618 is on microarray TOM1 spot ID 1-1-1.3.2.21 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C25703 [cLEF-14-H16] Trace: SGN-T59736 EST: SGN-E242703 Direction: 5' Facility: TIGR
Clone: SGN-C183618 [TUS-42-K8] Trace: SGN-T196039 EST: SGN-E394713 Direction: 5' Facility: INRA
Clone: SGN-C183618 [TUS-42-K8] Trace: SGN-T196039 EST: SGN-E399291 Direction: 5' Facility: INRA
Clone: SGN-C183618 [TUS-42-K8] Trace: SGN-T200314 EST: SGN-E399290 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394817Length: 346 bp (871 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E394817 [] (trimmed) ATGACTAAATAACATTAATATATATATATATATACTTGTGAAACACAATGTAACAAAATAAATAGTTACAAATTGAAAAAGTTATTTGGATGGGA
TAAATTCCATCAAGTTACAGAAAAAAAAAAAAACCAAACCAATTGGATACTAAAATGTCTAGCTAGAGCTAAACAAAAGTTGACAAAAAACAAAA
CTTGATAGCTACACAAATTTTAACTTGCTGAAATAAAATAAATAATGCTTCACTGATTTACGGCGTTGAACAGTCTTCAAATATCATAGCTAGGT
CTCCTTACCGGCTAACAAAAGAATGGAAGTTGCCGAAAAACCAACTCCCTTAAACTCGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394817] SGN-U564449 Tomato 200607 Build 2 121 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196143 [Download][View] Facility Assigned ID: FA0AAD30BF04FM2
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.896 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5