EST details — SGN-E394821
| Search information |
| Request: 394821 | Match: SGN-E394821 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C183662 | Clone name: TUS-42-M4 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C183662 is on microarray TOM1 spot ID 1-1-5.1.1.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C183662 [TUS-42-M4] | Trace: SGN-T196044 | EST: SGN-E394718 | Direction: 5' | Facility: INRA |
| Clone: SGN-C183662 [TUS-42-M4] | Trace: SGN-T200319 | EST: SGN-E399303 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E394821 | Length: 113 bp (918 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E394821 [] (trimmed)
CAGTAATTTAACACAAAAATCAACACATTATGCACTATAAGGAATATGGTTAATATTAGATAAATACAAGTAGCCTTGATGTTGCTCTTCGAGGA
AATTTGTGGTGGACTATG
AATTTGTGGTGGACTATG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E394821] | SGN-U584686 | Tomato 200607 | Build 2 | 52 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T196147 [Download][View] | Facility Assigned ID: FA0AAD30BG02FM2 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.882 | Expected Error Rate: 0.0082 | Quality Trim Threshold: 14.5 |
Working
