EST details — SGN-E394968

Search information 
Request: 394968Match: SGN-E394968
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180466Clone name: TUS-34-G24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180466 is on microarray TOM1 spot ID 1-1-1.3.19.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C30260 [cLEF-57-A6] Trace: SGN-T63856 EST: SGN-E249727 Direction: 5' Facility: TIGR
Clone: SGN-C180466 [TUS-34-G24] Trace: SGN-T199698 EST: SGN-E398372 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E394968Length: 250 bp (775 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E394968 [] (trimmed) ACAAAATGTACTACAGGTGCCACACCCATACCAGGGGCATTTAACACCAATGCTACAGCTTGGTAGTATCCTTCATTCACAAGGCTTTTCTGTTA
TAGTTGCACATACTCAATACAATACTCCTAATTATTCCAATCATCCACAATTCATCTTCCATTCTATGGATGACGGATTACTGGGAATCCACATG
TCATTCCCGAGTTTACAAAACATATATGATATGAACGAAAACTGCAAGGCGCCTCTCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E394968] SGN-U584032 Tomato 200607 Build 2 77 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196294 [Download][View] Facility Assigned ID: FA0AAD22BD12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0181 Quality Trim Threshold: 14.5