EST details — SGN-E395016

Search information 
Request: 395016Match: SGN-E395016
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C182742Clone name: TUS-40-F20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C182742 is on microarray TOM1 spot ID 1-1-5.2.5.7 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C134269 [cTOD-8-K16] Trace: SGN-T143793 EST: SGN-E330719 Direction: 5' Facility: TIGR
Clone: SGN-C182742 [TUS-40-F20] Trace: SGN-T196343 EST: SGN-E395017 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395016Length: 322 bp (919 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395016 [] (trimmed) GTCAATAATTATGGGACACTTTAACAGTTGAAGAAGAAACAATTTACACATATCATGAATTTCTTTAACTATATGATCAATTAGATGCAAGATAT
GCAGCCCCAGCAGCAATCTGATAAGGCTTGAACTGCAGCCAGAGTGAACTTCGGAGCCTGCAAAAGGAAATCGACTAAGAATAGGAGGAGATATT
AATGCTTCACAAAAGTCACTTCCCTGAAAACTAAATGGATAGGAAACATCTGCAGCAACACCATATCATTTGATAGCCATATTTCAAGAACAGCA
TGGGATCCAAAACTTCTCAAAAGGCACATTGGCCAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395016] SGN-U565670 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196342 [Download][View] Facility Assigned ID: FA0AAD28DC10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5