EST details — SGN-E395048

Search information 
Request: 395048Match: SGN-E395048
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180769Clone name: TUS-35-D15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180769 is on microarray TOM1 spot ID 1-1-2.4.17.14 [Order] [Tomato Microarray Database]
See unigene SGN-U570669 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C69266 [cLEN-9-J15] Trace: SGN-T89013 EST: SGN-E275141 Direction: 5' Facility: TIGR
Clone: SGN-C180769 [TUS-35-D15] Trace: SGN-T196375 EST: SGN-E395049 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395048Length: 533 bp (893 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395048 [] (trimmed) AGGAATAAAAAAATAATATATATAATAAAAGAATTGCAAGTTTAATAAAGTACATATACATATCATATATTATATGTTTTCAGCCTCATCTATTA
TACTACATTACTATTTTACACTGCACAAGACCTAAGTCCTCCTCTAGCTCGAGACTATTGATTAAAATATTATATAACTCGAATCATAATATCAC
TGATCTGAACTTCTTTATAGCCTCGAACATGCATTTAAAACTTAAAGCCATGGCTAGCTCCATATTATCATTCAATATATATCGAATGAGCACGT
GATATTCAGAAAATTAGGTCAAGACATATAGACCTCTAATCTCTTCGATGCTCGAGTTTCACCCTTATAATGATATATAATCTTATGAAAATATA
TACCATAGTATATAATTAATGCCCATTACACTTGTGTACTACACTCACCTTTTCCAAATCCCACTCTTCGATTTCTCAAATCAAATTCTACCCAT
AGATTTTGCTGATGAAAATTGCCAATAATATTACTTGCAATACCAAGTGATTCTGACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395048] SGN-U570669 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196374 [Download][View] Facility Assigned ID: FA0AAD23CB08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.915 Expected Error Rate: 0.0034 Quality Trim Threshold: 14.5