EST details — SGN-E395110

Search information 
Request: 395110Match: SGN-E395110
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181695Clone name: TUS-37-K5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181695 is on microarray TOM1 spot ID 1-1-4.3.12.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C21611 [cLED-34-J21] Trace: SGN-T57414 EST: SGN-E243640 Direction: 5' Facility: TIGR
Clone: SGN-C181695 [TUS-37-K5] Trace: SGN-T196437 EST: SGN-E395111 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395110Length: 121 bp (983 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395110 [] (trimmed) GTATATAAAAAAGGGGTGAAAATGATACTTGTATGGTTTTTGCAGGAACAATATTTGCCTAAGACCTCCTGTTTACTGATAATCTAAGAAGAATC
ATAAAATGCAATAAATATCCCTCCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395110] SGN-U581335 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196436 [Download][View] Facility Assigned ID: FA0AAD25AF03FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.891 Expected Error Rate: 0.0144 Quality Trim Threshold: 14.5