EST details — SGN-E395616

Search information 
Request: 395616Match: SGN-E395616
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C173610Clone name: TUS-16-J8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C173610 is on microarray TOM1 spot ID 1-1-1.2.18.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3946 [cLEC-23-B14] Trace: SGN-T28341 EST: SGN-E206382 Direction: 5' Facility: TIGR
Clone: SGN-C173610 [TUS-16-J8] Trace: SGN-T196943 EST: SGN-E395617 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395616Length: 332 bp (927 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395616 [] (trimmed) AGATGTATTGAAAATACCACTCCTAAAGTGCGTAAAATACAACTTATTCAAAATTCAAATAGAATTCAACTCCTAATTAAAAGGGCTAACCAGTT
GACTAGATTCATCTAAATAAAATAACTTGCAATAATAATTTAACAATTCTAAAACATAGAAGAGCTTCAGCACTGTTGTTATAATGTGTATATTT
GCAGTTCACATTCTACCAACTCACACCCTGCCTGACATGAAACACCAATGGAGGAAAAAATCTTCCTCTGTAGGGGCGTTGAAATCCACTGCGAG
CTGTAGGTCATATTTTTTTCTCTCCCTGTGGTGGGCTTTTTTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395616] SGN-U586607 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T196942 [Download][View] Facility Assigned ID: FA0AAD4DE04FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.907 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5