EST details — SGN-E395862

Search information 
Request: 395862Match: SGN-E395862
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174261Clone name: TUS-18-E11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174261 is on microarray TOM1 spot ID 1-1-6.1.16.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C174261 [TUS-18-E11] Trace: SGN-T197121 EST: SGN-E395795 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395862Length: 227 bp (1001 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E395862 [] (trimmed) CAAAATCATATTAATCAATTGACTTAGATATTTTGATTGATAGAAGATGCCGATGCGACCAACAGGGGGACTTAAACAAGATTGGGATCCAATCG
TGCTGCAGAAGCCAAAGATGAAGGCCCAAGACCTGAAGGATCCAAAAATTGTGAATCAGGCATTGCGAGCTGGAGCACAAGTTCAAACGGTGAAG
AAAATCGACGCTGGTTTGAATAAGAAGGCGGCGACGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395862] SGN-U566716 Tomato 200607 Build 2 32 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197188 [Download][View] Facility Assigned ID: FA0AAD6AC06FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.941 Expected Error Rate: 0.0048 Quality Trim Threshold: 20.5