EST details — SGN-E395911

Search information 
Request: 395911Match: SGN-E395911
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174289Clone name: TUS-18-F15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174289 is on microarray TOM1 spot ID 1-1-2.2.16.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C7833 [cLEC-40-G5] Trace: SGN-T32026 EST: SGN-E209962 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E395911Length: 116 bp (907 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E395911 [] (trimmed) CAGGAAAGCTCTAAGAACTCTATCCCCCTTCAATATTCTCACCCATCCCTATATCAATTGCTCTCCTCCAGCTTGCCTTCAACGAGAAATCGACG
ATGATTCCTTCAGTGGAGCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E395911] SGN-U603419 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197237 [Download][View] Facility Assigned ID: FA0AAD6CC08RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0480 Quality Trim Threshold: 14.5