EST details — SGN-E396076

Search information 
Request: 396076Match: SGN-E396076
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C174549Clone name: TUS-19-A11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C174549 is on microarray TOM1 spot ID 1-1-6.1.15.8 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C23206 [cLED-4-M2] Trace: SGN-T49263 EST: SGN-E231494 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396076Length: 191 bp (923 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E396076 [] (trimmed) GTCTTTGTGGCAGTGATGTTGGCCCAGATTGAGGTTCTGAGGAAGAAAGGACATTCTTACTCCGAGATTATCAAGGAAAGCGTCATCGAGTCTGT
AGATTCTTTGAATCCGTTTATGCACGCTCGTGGAGTATCATTCATGGTTGACAATTGCTCAACAACAGCACGTCTAGGTTCCAGGAAGTGGGCCC
C
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396076] SGN-U572728 Tomato 200607 Build 2 104 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197402 [Download][View] Facility Assigned ID: FA0AAD7AA06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5