EST details — SGN-E396568

Search information 
Request: 396568Match: SGN-E396568
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184048Clone name: TUS-43-M6
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184048 is on microarray TOM1 spot ID 1-1-3.1.19.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C3498 [cLEC-20-M22] Trace: SGN-T27776 EST: SGN-E205994 Direction: 5' Facility: TIGR
Clone: SGN-C184048 [TUS-43-M6] Trace: SGN-T1810 EST: SGN-E378460 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396568Length: 462 bp (870 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E396568 [] (trimmed) GTGACTTCTAATGGCATGATGACCCAGTACTATTTTCCATTTTGCTCTTGAGTCACTTATCGCATTCGCTAAATCTTTTAGCACGTTTTCTGTAT
ATGTCTTTTGAAGCATCGCATTGCGCCAATCATACGTATGTTTCGATTCCACGAAGTACTCTTTCAAAGATGGGGTTGTGTACACCATGAATATT
TCAACTCATTCTGCAATGATTATAAAGAAACGCAAACAAATCCATCTGCTGTCGATTTTCCTAAGGTAAGGACTAAGTTGAGCCTCTACATCTCC
CCTGTAATCATGGTTACCCAATACCGTATACCATTGGTTTTGCAAGCTCTTTGCTTTATAAACATTGGTAAAAGACTCCAGAAAATTTGGATCAT
GCTCCCCTGTTAGCCCATTATTATAAAAATTGTCACCTGTTGAAACTACAAAATCTATGTCTAGTTCCTCTCCCAATTTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396568] SGN-U579724 Tomato 200607 Build 2 74 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T197894 [Download][View] Facility Assigned ID: FA0AAD31BG03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0232 Quality Trim Threshold: 14.5