EST details — SGN-E396711

Search information 
Request: 396711Match: SGN-E396711
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183981Clone name: TUS-43-J11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183981 is on microarray TOM1 spot ID 1-1-6.2.18.1 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C5388 [cLEC-31-K22] Trace: SGN-T29693 EST: SGN-E206727 Direction: 5' Facility: TIGR
Clone: SGN-C183981 [TUS-43-J11] Trace: SGN-T198036 EST: SGN-E396710 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396711Length: 330 bp (900 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E396711 [] (trimmed) TTCTTTTATGTGACGGACGATGGGGTCTTACCCTTGAAACTTCTTCTTCTAATTCTGATAGAGCTGGTTTCTTCAAGAACAAGCCTGTTTTTGGT
TTTAATTTAAGTCCTAAATTTAACGCTGCTGATCTGTTTTCCTCCTCCGATGAAAAACCTAGCATCCTTAATGAAGTCTACTTTTTCTCCGATAA
AAAGCCTATTGTAAAGAAGGAAAATTCTCAGACCGATAATTCTATCATAACTGATGATCAGTGTGTTGTAAATACTGGTTTGCAACTTGTGATTG
CAAACGCGGGAAGTGATCAGTCAACGGTAGATGATGGGGTTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396711] SGN-U571282 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198037 [Download][View] Facility Assigned ID: FA0AAD31CE06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0173 Quality Trim Threshold: 14.5