EST details — SGN-E396769

Search information 
Request: 396769Match: SGN-E396769
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C183840Clone name: TUS-43-D14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C183840 is on microarray TOM1 spot ID 1-1-3.4.19.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C6962 [cLEC-37-G14] Trace: SGN-T31199 EST: SGN-E208208 Direction: 5' Facility: TIGR
Clone: SGN-C183840 [TUS-43-D14] Trace: SGN-T197942 EST: SGN-E396616 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396769Length: 183 bp (910 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396769 [] (trimmed) GGAAGAAAATTATGTATATTTCTCGATCACTTTACATTACAATTAACTAATTAATAAATCCACTCCACTAATTACTGGTTAATTATAGAACCTTT
TAATGGATTTGTGAAGGAATACCTTAAAAGTGAGGCTTTTGATCTCCCATGGAAAAAAAAATTTTGGTTTAATTGTCGGAGGAGCCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396769] SGN-U570501 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198095 [Download][View] Facility Assigned ID: FA0AAD31DB07FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.839 Expected Error Rate: 0.0173 Quality Trim Threshold: 14.5