EST details — SGN-E396795

Search information 
Request: 396795Match: SGN-E396795
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184022Clone name: TUS-43-L4
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184022 is on microarray TOM1 spot ID 1-1-5.4.19.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C22729 [cLED-3-D1] Trace: SGN-T49114 EST: SGN-E228466 Direction: 5' Facility: TIGR
Clone: SGN-C184022 [TUS-43-L4] Trace: SGN-T197971 EST: SGN-E396645 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396795Length: 475 bp (883 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E396795 [] (trimmed) AATACCAACAAAAGTCAAATTAAAGACTGTTATGCAAGAAAATAAAAGGACCTCATTTATGTGGGGCCACCAATACATTCCTTTAAAAGAAAAAT
CACTATTAGCTAGTCAAAATCTTCTAGGAAGATGAAAAAAATATTCTAGTAGTACAACAAAAATTATCCAAATGAAAAAAAAGGGTGATCATAAA
TTGACGAATTAAAAAAATTTGTAGTTTGATGAAAATCACTTCCACCACTAGTACTACCTGCCTGAAAATACGGCTCCTGCTGCACCATGTGATGA
TTCCGTTCAATAAAATTGGAACGATACAAAGATGAAGTGTGAGCTATAGGCTCAATAAAATTTGAAGGATTGGTGTGAAGTATAGGCTCCACTTC
CGTAAAGGTATGTCCAATAATAAAATTGGAACGATACGGAAAAATGGCTGGGTCGGGTGAGGAGTAAATGGGTTGTTGAATTGAAAAAGGCACTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396795] SGN-U586439 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198121 [Download][View] Facility Assigned ID: FA0AAD31DF02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5