EST details — SGN-E396916

Search information 
Request: 396916Match: SGN-E396916
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184175Clone name: TUS-44-B13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184175 is on microarray TOM1 spot ID 1-1-4.2.16.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C22557 [cLED-38-J4] Trace: SGN-T58229 EST: SGN-E244617 Direction: 5' Facility: TIGR
Clone: SGN-C184175 [TUS-44-B13] Trace: SGN-T199970 EST: SGN-E398644 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E396916Length: 454 bp (857 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E396916 [] (trimmed) ACCCTGAATCAATACTCATTCCCCATACAATTCCTTTGGCAAGGATGATGAATACTGTTGGTAGATATATTCCACCAGAAGTAGTTGCTGTTCGT
GTACCGCTTTTACACCTCTCAAATTTTACTACTGACTGGGCTGAACTGTCTACTAGCAAGTTATGCGGTTATGGTTCTGGTTCTCCCGATGAATG
GCTTAAGAAAGTGGCGTGAACATGAGTTAGAACTTGTGCAAGTTGTCGCAGATCAGGTTGCTGTCGCTCTTTCACATGCTGCAATTTTAGAAGAT
TCCATGCGAGCCCATGATCAGCTCATGGAACAGAATATTGCTTTGGATGTAGCTCGACAAGAAGCAGAGATGGCCATCCGTGCACGTAACGACTT
CCTTGCTGTGATGAACCATGAAATGAGAACGCCCCTGCATGCAGTTATTGCTCTGTGCTCTCTGCTTTTAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E396916] SGN-U580538 Tomato 200607 Build 2 122 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198242 [Download][View] Facility Assigned ID: FA0AAD32CA07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0343 Quality Trim Threshold: 14.5