Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E397248

Search information 
Request: 397248Match: SGN-E397248
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184729Clone name: TUS-45-I15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184729 is on microarray TOM1 spot ID 1-1-2.1.14.13 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80006 [cLET-10-P13] Trace: SGN-T104934 EST: SGN-E290765 Direction: 5' Facility: TIGR
Clone: SGN-C184729 [TUS-45-I15] Trace: SGN-T198492 EST: SGN-E397166 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397248Length: 425 bp (884 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397248 [] (trimmed) GAGAAAATTTTACTACTATTATTGTAAGGTCTTCACTACTGATTTTGGCTTACATCAATTTCGAACGACATTCAATTAATTCCACTCAACAAAAT
GACAGAACACAATAACCAAAATATGTCACAGCAAAGATGCCAGATGATACTCCATTACAAGAGGGATCCATTGATAGTACCCAATGCAGAATCAG
AAATTACAGTAAAATTATTCAGCAAACACTCTTTCCTAAAATCCAACTATAACGACTCCATGGCATATATGAACCGTCAAGATAATGATGATGCT
GATCCTTTTTATGTCATGTCTGAGTTAAAGTTATGCCTTGCTATCAATGCTCATCGGCTCTGGTTCCTTGGGAGCAGAGTTGGCTGAGTTTGATG
AATCCTGCTTATTCAACTTTGCAAACATGTTCCCGTAAAACTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397248] SGN-U567765 Tomato 200607 Build 2 114 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198574 [Download][View] Facility Assigned ID: FA0AAD33AE08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5