EST details — SGN-E397252

Search information 
Request: 397252Match: SGN-E397252
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184765Clone name: TUS-45-K3
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184765 is on microarray TOM1 spot ID 1-1-6.3.14.9 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C80193 [cLET-11-I15] Trace: SGN-T105095 EST: SGN-E292632 Direction: 5' Facility: TIGR
Clone: SGN-C184765 [TUS-45-K3] Trace: SGN-T198498 EST: SGN-E397172 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397252Length: 488 bp (870 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397252 [] (trimmed) AAAAAAAACAAAAGGGCCCACCAAAAAAGTTTTTTTGACCTAAAAAGCAAATCAAACCCCCATTCCATCAATTCTTAAAAAATTTTAATTTCTTG
GGTGGGCCTTTTTACAATTTTCCAAAAACCAAAAAAAATTTTGCTAAAAAAAAAACCAAAAATAACCGGGGGTTAAACGGGCCCCAAATTCGGCC
CTTCCCCCCCCCCCCAAAAGCAAGGGGATTTGTCCCAAATTGGGGATTCATTGGGCCCCCGAAAGGTTCCCCCCCCCCCCCCCCGGGGGGGGGGG
GGGGGGGGGGTCGGCAAACAAAAACCCCCCCCGGGGGCGGGAAAAAAGCAAAGGGCCCCCCCCCCCCCAAAGGGGAGGGAGCGGGAAAAAACCGC
AAAAAAAAAAACCCGGCGAAGAAAAAACCAATCCTCCCCCCACAAAAAACCTCTGGGCAATGAGGCCAAAAACCCCCCCCCCGTGAAACCCCCAA
AAAAAGTCGCCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397252] SGN-U600111 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198578 [Download][View] Facility Assigned ID: FA0AAD33AF02FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.840 Expected Error Rate: 0.0289 Quality Trim Threshold: 14.5