Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E397271

Search information 
Request: 397271Match: SGN-E397271
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184875Clone name: TUS-45-O17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184875 is on microarray TOM1 spot ID 1-1-8.3.14.18 [Order] [Tomato Microarray Database]
See unigene SGN-U577253 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C184875 [TUS-45-O17] Trace: SGN-T198522 EST: SGN-E397196 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397271Length: 273 bp (886 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397271 [] (trimmed) ACTAGCCACTTAAGCTGGTACCAAACACAAAATGATACTACACTGCATACTTATGCTATTTTCATTACCTGACTTTTCATTGCACCTCATAAAGA
GAAGGGCAATACTAAAAGGAAAATGTTTAAATTGATGGGAACTCCAATCAACTTTTACAAAACAAAGGTGTGAAAAAAATTATTTGACAGTAACT
TTGCCAACCATTCCACCTCCCTGGAGAGGTGCACAGTAGAAAGTGTAAGTTCCTTTCTCACTCAAAGTGACACTGTATGTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397271] SGN-U577253 Tomato 200607 Build 2 198 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198597 [Download][View] Facility Assigned ID: FA0AAD33AH09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0318 Quality Trim Threshold: 14.5