EST details — SGN-E397310

Search information 
Request: 397310Match: SGN-E397310
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184830Clone name: TUS-45-M20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184830 is on microarray TOM1 spot ID 1-1-5.1.14.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C85767 [cLET-40-K1] Trace: SGN-T110316 EST: SGN-E295083 Direction: 5' Facility: TIGR
Clone: SGN-C184830 [TUS-45-M20] Trace: SGN-T196571 EST: SGN-E395245 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397310Length: 430 bp (919 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397310 [] (trimmed) AAGAACAAAATCGAGATCCGCATTAGCAAGTCTATGAGTATCTTATTTAATTGTAGTCTTAAGATTAAACATAAACTGGTAGAAGCAACACAACA
ACCAATTACGGTTAACCCTAGAACTCGACCCGACACGACCCGACCAAAGCAGTAGAGATAGTTTGAAATTAAAAACAAAGCCTAAAACGGCGACT
CAAATACATAAAAGACTGATAAAACTAGATCATCATCATCATCAGATCTAGAGTTGACCGCAGTCAGCAATAACCACAGGCTTGGAGCACCTTCC
AGAGCTAGATCCAACAGCCTCTGCCAACGTAATCACATCCATGCCTTCAACAACTTGTCCAAACACGACGTGCTTTCCGTTGAGCCACTCAGTCT
TAACGGTACAGATGAAAGACTGAAAAGCGTTGGTTCCAGGTCCAGCATTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397310] SGN-U577630 Tomato 200607 Build 2 444 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198636 [Download][View] Facility Assigned ID: FA0AAD33BG10FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0203 Quality Trim Threshold: 14.5