Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E397433

Search information 
Request: 397433Match: SGN-E397433
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184899Clone name: TUS-45-P17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184899 is on microarray TOM1 spot ID 1-1-8.4.14.18 [Order] [Tomato Microarray Database]
See unigene SGN-U577253 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C132433 [cTOD-2-K9] Trace: SGN-T141977 EST: SGN-E329363 Direction: 5' Facility: TIGR
Clone: SGN-C184899 [TUS-45-P17] Trace: SGN-T200054 EST: SGN-E398728 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397433Length: 272 bp (863 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397433 [] (trimmed) ACAGTCCATAAAAGCTGGTATTAATCACAAAATGACATTACATGGATACATATGCAACTTTAATTTCCTGAGTTTTCATTACACCTCAAAAAGAG
AAGGGCAATACTAAAAGGAAAATGTTGAAATTGATGGGAACTCAAATCAACTTTTACAAAACAGAGGTGTGAAAAAAATTAGTTGACAGTAACTT
TGCCAACCATTCCAGCTCCCTGGTGAGGTGCACAGTAGAAAGTGTAAGTTCCTTTCTCACTCAAAGTGACACTGTATGTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397433] SGN-U577253 Tomato 200607 Build 2 198 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198759 [Download][View] Facility Assigned ID: FA0AAD33CH09FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.918 Expected Error Rate: 0.0017 Quality Trim Threshold: 12.5