EST details — SGN-E397468

Search information 
Request: 397468Match: SGN-E397468
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C184618Clone name: TUS-45-D24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C184618 is on microarray TOM1 spot ID 1-1-1.4.14.15 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C145357 [cTOF-29-G9] Trace: SGN-T160305 EST: SGN-E348737 Direction: 5' Facility: TIGR
Clone: SGN-C184618 [TUS-45-D24] Trace: SGN-T198793 EST: SGN-E397467 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397468Length: 408 bp (834 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397468 [] (trimmed) GTCAACCTCATATCTCTTCTCATTTTTTTTATTGGATATTTACTTTGTGTTCTTGAATTGTTCAACCACTTTTTATTTAAAGTTAGATAAGATTT
CTTCTTTCAACTTAAATATCAATATTTTTAAAGGGTATTTTGGTTAAGATTTTCTTCTTTTCTTGAAAATCTTTCCAATTTTTTATTTTTTTTGG
GAATGACGATAAAAATGATAGCAATTTTTGGTATTGTGATATTGGCACTAATTTATAAGGCAATTATTCCACCATCACCAAAGATTTGTGGTTCA
CCAAATGGATTTTTAATTACAGCACCAAGAATTAAGCTTTCTGATGGGAGATATTTGGCTTATAAAGAAAATGGTGTTCCTAGAGATGAAGCAAA
ACACAAATTTGTATTCATTCATGGGGGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397468] SGN-U572013 Tomato 200607 Build 2 33 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T198794 [Download][View] Facility Assigned ID: FA0AAD33DB12RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.889 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5