EST details — SGN-E397645
| Search information |
| Request: 397645 | Match: SGN-E397645 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C185217 | Clone name: TUS-46-M23 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C185217 is on microarray TOM1 spot ID 1-1-2.1.11.3 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C16489 [cLED-16-K5] | Trace: SGN-T52455 | EST: SGN-E235882 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C185217 [TUS-46-M23] | Trace: SGN-T198970 | EST: SGN-E397644 | Direction: 3' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E397645 | Length: 168 bp (856 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E397645 [] (trimmed)
CAGTTTATCTCTATTTTTACACAATGGTTCTCTCAAAAACTTCCTCTGAGTCTGATGTTTCTGTACACTCCACCTTTGCTTCTCGCTATGTTCGA
ACTTCACTTCCAAGGTTTGAGATGCCAGAAAATTCTATCCCAAAAGAGGCAGCATACCAAATAATTAATGATG
ACTTCACTTCCAAGGTTTGAGATGCCAGAAAATTCTATCCCAAAAGAGGCAGCATACCAAATAATTAATGATG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E397645] | SGN-U578934 | Tomato 200607 | Build 2 | 18 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T198971 [Download][View] | Facility Assigned ID: FA0AAD34AG12RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.932 | Expected Error Rate: 0.0196 | Quality Trim Threshold: 14.5 |
Working
