EST details — SGN-E397679

Search information 
Request: 397679Match: SGN-E397679
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185122Clone name: TUS-46-I24
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185122 is on microarray TOM1 spot ID 1-1-1.1.11.2 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C32974 [cLEG-24-M22] Trace: SGN-T67781 EST: SGN-E253533 Direction: 5' Facility: TIGR
Clone: SGN-C185122 [TUS-46-I24] Trace: SGN-T196590 EST: SGN-E395264 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397679Length: 114 bp (948 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397679 [] (trimmed) ACCCAGAAACTTCATATGGGATTTATTAACGTACAGGGGAAAATTAACAAGCAACACACGAAAAGCAATACTATAAATATATGTGATAACTCACT
CGTTCTATCACTACTTTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397679] SGN-U562944 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199005 [Download][View] Facility Assigned ID: FA0AAD34BE12FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.894 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5