EST details — SGN-E397740

Search information 
Request: 397740Match: SGN-E397740
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185275Clone name: TUS-46-P9
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185275 is on microarray TOM1 spot ID 1-1-8.4.12.20 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82323 [cLET-1-J20] Trace: SGN-T102519 EST: SGN-E292245 Direction: 5' Facility: TIGR
Clone: SGN-C185275 [TUS-46-P9] Trace: SGN-T1887 EST: SGN-E378648 Direction: 5' Facility: Giov. Lab
Clone: SGN-C185275 [TUS-46-P9] Trace: SGN-T199119 EST: SGN-E397793 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397740Length: 547 bp (885 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397740 [] (trimmed) CTCACACACCTAACAAATAACAAACCAAAACACTCTTTTCTTTTTCTTCATCTTTTTCTCAATATTTTCTTCCTTTTAACAACTATGGCAACAAC
AAGAAAAACCAAAAATTTCCTCTTCTTAGGTGGAAAAGACAAAATTACCCCTCTTCCATCAAGCACAAATACCCTCCAATTTGAATTTGATGAAG
CTGAAATGTGGAGTAATTCGGAAGAAATTAACAATGTTGAACCAAAATTATCAATACCAAGTTCAAGATTATCGAAAAAAATGACGAAAAAGGGC
GAAAGAAAGGCGATCAATGCGACGTCGTTGCCTGTGAATATACCTGATTGGTCGAAAATATTAGGTGATGATGAGAAGGGTATTTTGGGAAAAAA
TATTATGTTTGATGATGATGGAGATTTTGATGATGAAAATAGAATCCCACCACATGAATATTTAGCAAGAACAAGAGTTGCTTCATTTTCAGTAC
ATGAAGGAATTGGAAGGACATTAAAAGGAAAAGATTTAAGTATAGTTAAAAATGCTATTTGGAAAAAAAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397740] SGN-U584700 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199066 [Download][View] Facility Assigned ID: FA0AAD34CH05RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.929 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5