EST details — SGN-E397782

Search information 
Request: 397782Match: SGN-E397782
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C185185Clone name: TUS-46-L15
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C185185 is on microarray TOM1 spot ID 1-1-2.4.12.19 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C78076 [cLES-4-E4] Trace: SGN-T97985 EST: SGN-E282244 Direction: 5' Facility: TIGR
Clone: SGN-C185185 [TUS-46-L15] Trace: SGN-T199053 EST: SGN-E397727 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397782Length: 345 bp (886 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397782 [] (trimmed) GTCTAAATCAACCTTTTATTAATTGCCTTACGGACTTCTTTTACATTTCAGAATATTTTAAAAACTAAAATATTAAAATAAAATTACAAAAAAAT
AAAAATAAATTCCTATTACTATATGTGATACACTAATAAATTACCTTCTTATTTTTCTCCTTTTCTTTAAGGAAAAAAAAATGAACCATACCCTT
TGTGGTGTACTATATCTCAAGTACTATGGGAACTCTTTGTATTTACAATTTTAGGTCCTCAAACTTATGTGCTTGTCTAGGTCTTGGTCGCGCCT
TTTGGACTGATCAAGCTCGTGTAATGCCTAGTCGTGGTTCTTGAACTGATCAACCTCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397782] SGN-U583027 Tomato 200607 Build 2 86 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199108 [Download][View] Facility Assigned ID: FA0AAD34CF08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.911 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5