EST details — SGN-E397874

Search information 
Request: 397874Match: SGN-E397874
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C180774Clone name: TUS-35-D20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C180774 is on microarray TOM1 spot ID 1-1-5.4.17.18 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C10919 [cLEC-6-K16] Trace: SGN-T23971 EST: SGN-E202310 Direction: 5' Facility: TIGR
Clone: SGN-C180774 [TUS-35-D20] Trace: SGN-T193935 EST: SGN-E392609 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397874Length: 207 bp (824 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397874 [] (trimmed) ATACGATTAAGACAATCAATTGATGGTAAACCAAAAATATAATATGCACTTGTATTAAAGAACATAGTACCCCTTTCTCATCTAGTTGCTAATCC
ATTGATTAAGCATTGAATCTGCAATCTTTAAGTCATGAGCCTGCTCAGGAGCAGGGGGTCTTCTCCAACAAAAGTCAATCTTTCAATCCTTTGGC
AAAAAGCACTTTCTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397874] SGN-U568957 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199200 [Download][View] Facility Assigned ID: FA0AAD23DB10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5