EST details — SGN-E397989

Search information 
Request: 397989Match: SGN-E397989
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181586Clone name: TUS-37-F16
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181586 is on microarray TOM1 spot ID 1-1-1.2.12.6 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C146771 [cTOF-33-O7] Trace: SGN-T161501 EST: SGN-E347439 Direction: 5' Facility: TIGR
Clone: SGN-C181586 [TUS-37-F16] Trace: SGN-T194388 EST: SGN-E393062 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397989Length: 473 bp (840 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E397989 [] (trimmed) GCTGGAAAAAGATCATTGCTGATTAAACAATGGATTAAAAACTGAACACCCTCAGTGAAAGTCCAAACCGTCTTACAAATACTTTTATCACAATT
AATTTCTTACAGACAACATGATACATTACCTACACCACTTGACATACACTGAAACCTTTCCTTCTATTTTATTTTCTAGTAAGTACACAAAATCA
TACCCCCTGGGAAATGTCACCCAATGAACCATGTCATTCAAAACGATTCCAGAAAAAATTAAAAATTCACCAAACTGTTTTGCATCAATACCCAT
TTCATTGTTCTTCTTGAAATCAATCCCAAAATGAATCAGCAATTCCATTGAATCATTTGCAAAAATATTTGCTTTTGTATCGAACTCCCGAAAGT
TGAATTGCCAAACGTAATAATACTCACTCTCACAAGTAGGTAAATTGCCATTTTCATCGGAAAATGTGAAACCTAACTGAATCAAGTTCAACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397989] SGN-U576292 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199315 [Download][View] Facility Assigned ID: FA0AAD25DC08FM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.912 Expected Error Rate: 0.0155 Quality Trim Threshold: 12.5