Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E397994

Search information 
Request: 397994Match: SGN-E397994
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181782Clone name: TUS-37-N20
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181782 is on microarray TOM1 spot ID 1-1-5.2.12.12 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181782 [TUS-37-N20] Trace: SGN-T194632 EST: SGN-E393306 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397994Length: 391 bp (889 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397994 [] (trimmed) TTTATTACCTTTTTTAGACATCTTTAATTGAAGTACTTGTTTGTTCTCTCTTAAGGATCGGTTCGAAAGTTTAAGTTTGAGTTCTCTGTGATCTC
AATCAACAGATTTATTTGTTTTTGCTCTTCTAAAAAGCAGATTTCAATACTGATGACAACCTCCAACACACAACAAAGCTATGACAAAACAAGTG
AACTAAAAGCCTTTGATGACACAAAAGCAGGTGTCAAAGGACTTATTGATAGTGGAATTACTAAAGTACCTCAAATATTCATTCATCCAGAGGCC
TTATATTTATTACCACAAATCCCAAAAATACACATTTCGTTTTCCCTTTAATAGACCTCCAAAACATCAGCATTAACCACAAAGAGATAGTGAAA
CAAATTCAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397994] SGN-U579236 Tomato 200607 Build 2 37 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199320 [Download][View] Facility Assigned ID: FA0AAD25DG10RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5