EST details — SGN-E397996

Search information 
Request: 397996Match: SGN-E397996
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C181869Clone name: TUS-38-B11
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C181869 is on microarray TOM1 spot ID 1-1-6.2.10.11 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C82257 [cLET-1-G2] Trace: SGN-T102620 EST: SGN-E292346 Direction: 5' Facility: TIGR
Clone: SGN-C181869 [TUS-38-B11] Trace: SGN-T199363 EST: SGN-E398037 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E397996Length: 481 bp (895 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E397996 [] (trimmed) GAAAAGGAGAAGGTAACAATAGGTCAGGAAGAGATTCAAAGAAGAGCACTTCAGATTGAAAACATGTCTACTAAGTTAGAAGAGATGGAAAGGTT
TGCTTTTGGTACAAATTGTATCTTGAATGAGATGCGCCAGAGAGTTGAAGATTTGGTCGAAGAAACTTCTAGACAGAGACAGCGAGCTGCAGAAA
ATGAGCAGGAGCTTTGTTGTGTTAAGAGAGACTTCGAATCTCTGAAATCCTATGTCAGTGGTCTCATTAGTGTCAGAGAAACTCTTCTGTCATCA
GAAAAACAATTCCAGACAATTGAAAAGCTTTTTGAACGGTTAGCTGCAAAGACAACTCAATTGGAGAGTGAGAAAATGCAGAAAGAATTTCAAGT
CCAAAAGCTTATATAACAAAATGTGAAGTTGACTACTCTTCTTGACAAGAAAGAAGGCGGGGTCGTAGCCATAAATGAACAATGCAAGGTTATGG
CACTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E397996] SGN-U576697 Tomato 200607 Build 2 26 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T199322 [Download][View] Facility Assigned ID: FA0AAD26CA06RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5